SEPTEMBER/OCTOBER 2022 VOL 33 NO 5 • PRELP promotes myocardial fibrosis and ventricular remodel l ing • Microalbuminuria, serum l ipids and inflammatory markers • Monopolar electrocautery in pedicular internal thoracic artery harvesting • Brachiobasi l ic arteriovenous fistulae for haemodialysis • Endovascular treatment of Buerger ’s disease in critical l imb ischaemia • Out-of-hospital cardiac arrests in the city of Cape Town metropole • 2022 SASCI/SCTSSA joint consensus statement and guidel ine on TAVI • Pulmonary embol ism caused by right atrial myxoma • Fatal pulmonary oedema associated with severe pre-eclampsia CardioVascular Journal of Afr ica (off icial journal for PASCAR) www.cvja.co.za
DO NOT DISTURB IMPROVE QUALITY OF LIFE SILDENAFIL 50 mg•100 mg For further product information contact PHARMA DYNAMICS Email info@pharmadynamics.co.za CUSTOMER CARE LINE +27 21 707 7000 www.pharmadynamics.co.za DYNAFIL 50, 100 mg. Each tablet contains sildenafil citrate equivalent to 50, 100 mg sildenafil respectively. S4 A42/7.1.5/1071, 1072. NAM NS2 13/7.1.5/0086, 0087. For full prescribing information, refer to the professional information approved by SAHPRA, 15 March 2021. DLA872/09/2022.
ISSN 1995-1892 (print) ISSN 1680-0745 (online) Cardiovascular Journal of Afr ica www.cvja.co.za CONTENTS INDEXED AT SCISEARCH (SCI), PUBMED, PUBMED CENTRAL AND SABINET Vol 33, No 5, SEPTEMBER/OCTOBER 2022 EDITORS Editor-in-Chief (South Africa) PROF PAT COMMERFORD Assistant Editor PROF JAMES KER (JUN) Regional Editor DR A DZUDIE Regional Editor (Kenya) DR F BUKACHI Regional Editor (South Africa) PROF R DELPORT EDITORIAL BOARD PROF PA BRINK Experimental & Laboratory Cardiology PROF R DELPORT Chemical Pathology PROF MR ESSOP Haemodynamics, Heart Failure & Valvular Heart Disease DR OB FAMILONI Clinical Cardiology DR V GRIGOROV Invasive Cardiology & Heart Failure PROF J KER (SEN) Hypertension, Cardiomyopathy, Cardiovascular Physiology DR J LAWRENSON Paediatric Heart Disease PROF A LOCHNER Biochemistry/Laboratory Science DR MT MPE Cardiomyopathy PROF DP NAIDOO Echocardiography PROF B RAYNER Hypertension/Society PROF MM SATHEKGE Nuclear Medicine/Society PROF YK SEEDAT Diabetes & Hypertension PROF H DU T THERON Invasive Cardiology INTERNATIONAL ADVISORY BOARD PROF DAVID CELEMAJER Australia (Clinical Cardiology) PROF KEITH COPELIN FERDINAND USA (General Cardiology) DR SAMUEL KINGUE Cameroon (General Cardiology) DR GEORGE A MENSAH USA (General Cardiology) PROF WILLIAM NELSON USA (Electrocardiology) DR ULRICH VON OPPEL Wales (Cardiovascular Surgery) PROF PETER SCHWARTZ Italy (Dysrhythmias) PROF ERNST VON SCHWARZ USA (Interventional Cardiology) SUBJECT EDITORS Nuclear Medicine and Imaging DR MM SATHEKGE Heart Failure DR G VISAGIE Paediatric DR S BROWN Paediatric Surgery DR DARSHAN REDDY Renal Hypertension DR BRIAN RAYNER Surgical DR F AZIZ Adult Surgery DR J ROSSOUW Epidemiology and Preventionist DR AP KENGNE Pregnancy-associated Heart Disease PROF K SLIWA-HAHNLE 227 FROM THE EDITOR’S DESK CARDIOVASCULAR TOPICS 228 PRELP promotes myocardial fibrosis and ventricular remodelling after acute myocardial infarction by the wnt/β–catenin signalling pathway Y Zhang • C Fu • S Zhao • H Jiang • W Li • X Liu 234 Association of microalbuminuria with serum lipids and inflammatory markers in an adult population in the Dikgale Health and Demographic Surveillance System (HDSS) site, South Africa T Magwai • P Modjadji • S Choma 243 Identifying the optimal monopolar electrocautery output power in pedicular internal thoracic artery harvesting: 20 or 40 watts? EC Ata • GE Şentürk • HI Saygi • MÖ Ulukan • M Uğurlucan • K Erkanli • MO Beyaz • E Yildiz 248 The use of brachiobasilic arteriovenous fistulae for haemodialysis: a single-centre descriptive study T du Toit • K Chibuye • D Thomson • K Manning 254 Endovascular treatment of Buerger ’s disease in patients with critical limb ischaemia D Serefli • O Saydam 260 Out-of-hospital cardiac arrests in the city of Cape Town metropole of the Western Cape province of South Africa: a spatio-temporal analysis W Stassen • E Theron • T Slingsby • C Wylie
CONTENTS Vol 33, No 5, SEPTEMBER/OCTOBER 2022 FINANCIAL & PRODUCTION CO-ORDINATOR ELSABÉ BURMEISTER Tel: 021 976 8129 Fax: 086 664 4202 Cell: 082 775 6808 e-mail: elsabe@clinicscardive.com PRODUCTION EDITOR SHAUNA GERMISHUIZEN Tel: 021 785 7178 Cell: 083 460 8535 e-mail: shauna@clinicscardive.com CONTENT MANAGER MICHAEL MEADON (Design Connection) Tel: 021 976 8129 Fax: 0866 557 149 e-mail: michael@clinicscardive.com The Cardiovascular Journal of Africa, incorporating the Cardiovascular Journal of South Africa, is published 10 times a year, the publication date being the third week of the designated month. COPYRIGHT: Clinics Cardive Publishing (Pty) Ltd. LAYOUT: Jeanine Fourie – TextWrap PRINTER: Tandym Print/Castle Graphics ONLINE PUBLISHING & CODING SERVICES: Design Connection & Active-XML.com All submissions to CVJA are to be made online via www.cvja.co.za Electronic submission by means of an e-mail attachment may be considered under exceptional circumstances. Postal address: PO Box 1013, Durbanville, RSA, 7551 Tel: 021 976 8129 Fax: 0866 644 202 Int.: +27 21 976 8129 e-mail: info@clinicscardive.com Electronic abstracts available on Pubmed Audited circulation Full text articles available on: www.cvja. co.za or via www.sabinet.co.za; for access codes contact elsabe@clinicscardive.com Subscription: To subscribe to the online PDF version of the journal, e-mail elsabe@clinicscardive.com • R500 per issue (excl VAT) • R2 500 for 1-year subscription (excl VAT) The views and opinions expressed in the articles and reviews published are those of the authors and do not necessarily reflect those of the editors of the Journal or its sponsors. In all clinical instances, medical practitioners are referred to the product insert documentation as approved by the relevant control authorities. REVIEW ARTICLE 267 2022 SASCI/SCTSSA joint consensus statement and guideline on transcatheter aortic valve implantation (TAVI) in South Africa J Hitzeroth • H Weich • J Scherman CASE REPORTS 270 Fire at the gate ruins fish: pulmonary embolism caused by right atrial myxoma K He • L Bian • W Liang • Z Wu 273 Fatal pulmonary oedema associated with severe pre-eclampsia: challenges and lessons NC Ngene • J Moodley 277 A rare endocrine cause of ventricular tachycardia: a case series of two patients and a literature review M Yu • L Sun • H-l Yang • H Sun • C Wang • S Yao • P Yang 282 The added value of molecular-based diagnostics in the African forensic medical setting BS van Deventer • MA Makhoba • L du Toit-Prinsloo • C van Niekerk PUBLISHED ONLINE (Available on www.cvja.co.za and in PubMed)
CARDIOVASCULAR JOURNAL OF AFRICA • Volume 33, No 5, September/October 2022 AFRICA 227 As I did most of my cardiology training in the late 1970s prior to the evolution of and dramatic advances in interventional cardiology, I have watched the developments in the field with awe and enormous respect for the practitioners who have pioneered many of the new techniques and the scientists and materials engineers whose work has contributed to the development of the many and varied devices that have made the procedures possible. The news of the first balloon coronary angioplasty by Gruentzig in 1977 was met with disbelief in some quarters but it, or variants, are now commonplace and often performed by relatively junior staff. Other interventions for the percutaneous catheter-based treatment of many different acquired or congenital structural heart diseases have evolved at an amazing rate and are now routine. Transcatheter aortic valve implantation (TAVI) for treatment of aortic stenosis is only one such procedure but is a truly remarkable one. In this issue of the Journal, Hitzeroth and colleagues (page 267) outline the South African Society of Cardiovascular Intervention (SASCI) and the Society of Cardiothoracic Surgeons of South Africa (SCTSSA) update on the joint consensus statement and guidelines on transcatheter aortic valve implantation (TAVI) in South Africa, last reviewed in 2016. Over the last 10 years, TAVI has become an established therapy in South Africa for many patients with aortic stenosis. Based on clinical trial evidence that has become available since then, the TAVI indications have expanded and this treatment modality can now be offered to a broader patient population. In addition to this, the TAVI technology has improved and the implantation technique has been streamlined. This has resulted in excellent procedural outcomes and reduced hospital stays. Furthermore, TAVI has been shown to be cost effective and this is of relevance in the South African resource-constrained environment. The authors and societies are to be congratulated on the update, particularly for their emphasis on the implications for performance of the procedure in a resource-constrained environment. Stassen and co-authors describe how the incidence of out-ofhospital cardiac arrest (OHCA) is expected to increase in sub-Saharan Africa (page 260). The condition carries a dismal survival rate in the best of settings. They argue that interventions to improve OHCA survival might not be cost effective for many low-resource settings, and therefore need to be targeted to areas of high incidence. The aim of this study was to describe the temporal and geographic distribution of OHCA in the city of Cape Town, South Africa, and their proximity to percutaneous coronary intervention (PCI) centres. In their description of the few interventions that have been demonstrated to improve the dismal prognosis, they describe that some interventions have been found to increase survival rate in OHCA, most notably bystander cardiopulmonary resuscitation (CPR) and early defibrillation of shockable dysrhythmias. CPR training, either through mass public training events or training targeted at family and friends of patients with high risk of sudden cardiac arrest, has been shown to increase the likelihood of bystander CPR and the quality of CPR performed. Similarly, public access placement of automated external defibrillators has been shown to decrease the time delays from collapse to defibrillation in OHCA. These interventions may be cost effective when they are targeted to areas of both a high concentration of potential victims and potential resuscitators. The authors are to be congratulated on describing the temporal and geographic distribution of OHCA in the city of Cape Town from this retrospective survey. However, as they acknowledge, there are not many PCI-capable facilities available to the majority of Cape Town citizens and it is unlikely that that will improve in the foreseeable future due to resource constraints, and early PCI may not be the most effective intervention. I feel it would be helpful if they had shared information on the availability or lack thereof of the interventions that are immediately remediable such as bystander-initiated CPR or defibrillator availability to all first-responder teams. Sudden unexpected infant death (SUDI), previously known as sudden infant death syndrome (SIDS), is reported to be extraordinarily common in sub-Saharan Africa, with the incidence rate in South Africa among the highest in the world. It is common for the cause of many such infant deaths to remain unexplained, even after a full medico-legal death investigation, and then to be categorised as a sudden unexplained infant death (SUID). The interesting case report by van Deventer and colleagues provides a perspective on the topic (page 280). Reviewers of this report were not unanimous in their responses but I took an editorial decision to publish it because although all conclusions may not be correct, the content of the case report and literature review emphasises the need for more careful investigation of SUDI cases by molecular-based diagnostics in the African forensic medical setting if a better understanding of this devastating condition is to be established. It remains a privilege to receive, edit and comment on a diverse array of articles that reflect both the strengths and weaknesses of cardiac services available in Africa and other areas with similar resource constraints. I would welcome letters to the Editor an any matter of disagreement or concern. Pat Commerford Editor-in-Chief From the Editor’s Desk
CARDIOVASCULAR JOURNAL OF AFRICA • Volume 33, No 5, September/October 2022 228 AFRICA Cardiovascular Topics PRELP promotes myocardial fibrosis and ventricular remodelling after acute myocardial infarction by the wnt/β–catenin signalling pathway Yu Zhang, Chunli Fu, Shaohua Zhao, Honglei Jiang, Wei Li, Xiangju Liu Abstract Objectives: Proline/arginine-rich end leucine-rich repeat protein (PRELP) has been reported to contribute to the remodelling of cardiovascular tissues in the ischaemia–reperfusion injury model. However, research is lacking on the role of PRELP in myocardial fibrosis and ventricular remodelling, and the mechanism through which PRELP brings about these changes is not clear. This study aimed to evaluate the role of PRELP in ventricular remodelling and myocardial fibrosis following acute myocardial infarction (AMI) and to explore the underlying mechanism. Methods: In this study, we established AMI mouse and cellculture models in an oxygen–glucose deprivation environment. Results: We found that over-expression of PRELP increased the infarct size and interstitial fibrotic area. Expression of the wnt/β–catenin pathway molecules, which are downstream of PRELP, increased more in the PRELP over-expression group than in the AMI group. Conclusions: Our results showed that PRELP, through the wnt/β–catenin signalling pathway, led to myocardial fibrosis and ventricular remodelling following AMI. Keywords: PRELP, myocardial fibrosis, acute myocardial infarction, wnt, β-catenin Submitted 25/2/21; accepted 20/12/21 Published online 29/6/22 Cardiovasc J Afr 2022; 33: 228–233 www.cvja.co.za DOI: 10.5830/CVJA-2022-001 Acute myocardial infarction (AMI), a serious and common cardiovascular disorder, is the leading cause of heart failure and sudden death,1-3 with increasing incidence worldwide.4 Myocardial fibrosis is an important pathological characteristic linked to AMI.5,6 It can lead to elevated rigidity, induce myocardial sclerosis, trigger ventricular remodelling, affect ventricular compliance and eventually induce heart failure.7 Therefore, more effort should be made to identify the molecular mechanisms of myocardial fibrosis. This will help provide novel insights into therapeutic targets and uncover effective strategies to alleviate myocardial fibrosis and ventricular remodelling following AMI. The small leucine-rich repeat protein family (SLRR), located in the extracellular matrix of connective tissue, has been found to play an important role in myocardial fibrosis and ventricular remodelling.8,9 There are several members in the SLRRs, such as biglycan, decorin, lumican and glypican-6. Recent studies showed that inhibition of biglycan or lumican expression can reduce myocardial fibrosis.10,11 It was also shown that glypican-6 is involved in cardiac remodelling by the extracellular signalrelated kinase (ERK) signalling pathway.12 Proline/arginine-rich end leucine-rich repeat protein (PRELP), which is another member of the SLRRs, can bind to the basement membranes of connective tissues more easily compared to other members of the SLRRs, as it contains a positively charged N-terminus rich in proline and arginine residue.13 Javier et al., for the first time, reported that several members of the small leucinerich proteoglycan family, including asporin and PRELP, were shown to contribute to cardiac remodelling.14 However, there is little research about PRELP’s role in myocardial fibrosis and ventricular remodelling post AMI. The mechanism by which PRELP brings about these changes is also not clear. The wnt signalling pathway is a relatively silent pathway that regulates important cellular activity such as cell proliferation, differentiation and apoptosis. β-catenin has been found to be one of the most important members in the wnt signalling pathway. The other downstream members of this pathway are glycogen synthase kinase 3 beta (GSK3β), matrix metallopeptidase 9 (MMP9), c-myc and tissue inhibitor of metalloproteinases-1 (TIMP-1). Previous studies have shown that wnt signalling gets activated following AMI.15 Sufficient activation of this signalling pathway can decrease the infarct size of the heart and alleviate heart failure, while excess activation can increase myocardial fibrosis and infarct sizes.16,17 A recent research study suggested that PRELP can regulate the differentiation of osteoblasts by the Shandong Key Laboratory of Cardiovascular Proteomics, Department of Geriatrics, Qilu Hospital of Shandong University, Jinan, Shandong, People’s Republic of China Yu Zhang, MM, zhangy19851208@126.com Chunli Fu, MD Shaohua Zhao, MD Xiangju Liu, MD, xiangjuliu@163.com Department of Cardiology, Shandong Provincial Western Hospital, Jinan, Shandong, People’s Republic of China Honglei Jiang, MD Department of Anesthesia, Shandong Provincial Hospital affiliated to Shandong First Medical University, Jinan, Shandong, People’s Republic of China Wei Li, MD
CARDIOVASCULAR JOURNAL OF AFRICA • Volume 33, No 5, September/October 2022 AFRICA 229 β-catenin pathway.18-20 Whether PRELP increases myocardial fibrosis post AMI by the wnt/β–catenin signalling pathway remains undetermined. In our study, we determined PRELP’s role in myocardial fibrosis post AMI and the underlying mechanisms involved in the process. Methods Male SD mice, aged eight weeks, were subjected to MI by ligation of the left anterior descending coronary artery, as previously described.21 After the mice were anaesthetised, the left anterior descending coronary artery was ligated. Mice in the sham group were also anaesthetised and their hearts were exposed. However, ligation of the coronary artery was not performed in this group. PRELP over-expressing lentiviral vector and PRELP interference-expressed lentiviral vector were generated by Genechem Corporation (Shanghai, China). All mice (n = 60) were randomly divided into four groups: SHAM, MI, MI + PRELP shRNA, and MI + PRELP over group. In the MI + PRELP over group, mice were injected with 1 × 106 PRELP over-expressing lentiviral vector in the myocardium around the ligation point. Additionally, 1 × 106 PRELP interference-expressed lentiviral vector was injected into the myocardium around the point of ligation of the mice in the MI + PRELP shRNA group. All experimental protocols were carried out in accordance with guidelines. All procedures were under approval from the animal care and use committee of Shandong University Qilu Hospital. The cardiac fibroblasts were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 10% foetal bovine serum, 100 units/ml penicillin and 100 mg/ml streptomycin at 37°C with 95% air and 5% CO2. To identify the fibroblasts, microscopy and immunofluorescence analysis were used. The cells were also randomly divided into four groups: SHAM, MI, MI + PRELP shRNA, and MI + PRELP over group. To mimic the ischaemic conditions, the cells were cultured in DMEM without foetal bovine serum (FBS), and with 0.1% O2 for 24 hours. PRELP over-expressing lentiviral vector was transfected into the cells in the MI + PRELP over group. PRELP interference-expressed lentiviral vector was transfected into the cells in the MI + PRELP shRNA group. Transfection efficiency was assessed by Western blotting, immunohistochemical staining and real-time polymerase chain reaction (PCR). The left ventricular internal diameter in diastole and the left ventricular internal diameter in systole of all the mice were measured with motion-mode (M-mode) echocardiography. Left ventricular fractional shortening (LVFS) and left ventricular ejection fraction (LVEF) were automatically calculated according to the formula. The heart tissues and the cells were lysed in RIPA buffer. The concentration of total proteins for each sample was quantified using a BCA kit, and 30 μg of each sample was electrophoresed in SDS-PAGE gel and transferred onto polyvinylidene difluoride membranes. After blocking with 5% fat-free milk at room temperature for one hour, the membranes were incubated with primary antibodies overnight at 4°C on a refrigerator shaker. All primary antibodies were dissolved in a 5% solution with a dilution of 1:1 000. Anti-wnt1 antibody (ab15251), anti-PRELP antibody (ab229719), anti-GSK3β antibody (ab93926), antiMM9P antibody (ab228402), anti-β-catenin antibody (ab6302), anti-c-myc antibody (ab32072) and anti-TIMP-1 antibody (ab81282) were purchased from Abcam Biotechnology. AntiGAPDH antibody (200306-7E4) was purchased from Zen Bioscience. Next, the membranes were washed three times at room temperature. Following the addition of the anti-rabbit (or antimouse, anti-goat) secondary antibodies (1:5 000, A0208, A0216, A0181, Beyotime), the membranes were incubated for two hours, followed by three washes at room temperature. Finally, protein expressions were visualised by an enhanced chemiluminescence system. The myocardial tissues were paraffin-embedded, sectioned and dewaxed. The cardiac fibroblasts were fixed in 4% paraformaldehyde for 10 minutes, and then treated with 0.5% Triton X-100 for 10 minutes. Next, they were incubated with primary antibodies overnight at 4°C. After three phosphatebuffered saline (PBS) washes, the slices were incubated with secondary antibodies for 50 minutes at 4°C. This was followed by three PBS washes. Finally, the sections were counterstained with haematoxylin to observe the cellular nuclei and were viewed under a microscope. The heart was sectioned into 1-mm-thick transverse slices and stored at –20°C for 20 minutes. The slices were then incubated with 1% triphenyltetrazolium chloride solution (TTC) at 37°C. The viable tissues stained red, while the infarcted tissues appeared pale. The percentage of infarcted area was quantified using image analysis software (Image-Pro Plus). The heart tissues were fixed, dehydrated and then sectioned into 4-μm sections. After they were dewaxed, hydrated and stained with haematoxylin and eosin (HE), and Sirius red (SR), the slices were dehydrated by gradient ethanol and finally viewed under a microscope. The total RNA content was extracted from cells using Trizol reagent. The RNA was quantified by a Nanodrop One, and the obtained RNA (0.6 μl) was subjected to reversetranscription reaction using the RT reagent kit. Real-time PCR of cDNA was done using a SYBR Premix Ex Taq kit, with GAPDH as the internal control. The primer sequences of PRELP were CTTCTGGTTCCTTCCACTTCTC (forward) and GGCCTTGGCTTGGGTTTA (reverse), and the primer sequences of GAPDH were GGGAAACCCATCACCATCTT (forward) and CCAGTAGACTCCACGACATACT (reverse). Results were calculated based on the 2Ct −ΔΔ method. Statistical analysis The experimental data for the three separate experiments are represented as mean±standard deviation (SD). SPSS 23.0 was used for statistical analyses; p-values < 0.05 were considered statistically significant. The t-test was used to compare the data between the two groups. Results As shown in Fig. 1, the ELISA assay, Western blotting and immunohistochemical staining analysis showed that the PRELP expression in the myocardial tissues was upregulated following AMI compared to that in the control mice. The PRELP expression in the myocardial tissues was upregulated in PRELP
CARDIOVASCULAR JOURNAL OF AFRICA • Volume 33, No 5, September/October 2022 230 AFRICA over-expression groups compared to that in the MI mice, and that of the sh-PRELP group was down-regulated compared to that in the MI mice. The Western blot and quantitative real-time PCR analysis also showed that the PRELP expression in the cardiac fibroblasts was increased post MI compared to the control cells. The PRELP expression in the cardiac fibroblasts was upregulated in the PRELP over-expression groups compared to that in the MI groups, and that of the sh-PRELP group was down-regulated compared to that in the MI groups. Echocardiography results showed that over-expression of PRELP reduced cardiac function following AMI, as assessed by the significantly decreased percentages of LVFS and LVEF, compared to the MI mice group. On the contrary, in the sh-PRELP groups, there was a significant increase in both LVFS and LVEF of the heart following AMI, compared to the MI mice group (Fig. 2A, B). The results indicate that PRELP can promote cardiac dysfunction following AMI. Over-expression of PRELP significantly increased the infarct size of the heart compared to the MI groups, and in the sh-PRELP groups, there was a significant decrease in infarct size of the heart following AMI, as assessed by TTC staining (Fig. 2C, 2D). These findings showed that PRELP increased adverse myocardial fibrosis and collagen deposition after AMI. HE and SR staining revealed a clear increase in infarct size, interstitial fibrotic area, and collagen accumulation in PRELP overexpression groups following MI. In contrast, in the sh-PRELP groups, there was a significant decrease in the infarct size and interstitial fibrotic area compared to the MI group and fibroblasts (Fig. 2E–G), indicating that PRELP can increase collagen deposition, promote adverse myocardial fibrosis and lead to ventricular re-modelling, which can cause heart failure post MI. Next, we investigated the effect of PRELP on activation of the wnt/β–catenin signalling pathway. As is already known, the downstream members of this pathway are β-catenin, GSK3β, MMP9, c-myc and TIMP-1. In our experiments, we used Western blotting and immunohistochemical staining analysis to Fig. 1. PRELP expression was upregulated in myocardial tissue and cardiac fibroblasts post MI. The PRELP protein levels in the myocardial tissues from mice were assessed using ELISA (A), Western blot (B and C) and immunohistochemical staining analysis (D). C. Quantification result from B. The PRELP protein levels in the fibroblasts were assessed using Western blot (E and F) and quantitative real-time PCR assays (G). F. Quantification result from E. *p < 0.05, **p < 0.01, ***p < 0.001 versus the control group; #p < 0.05; ##p < 0.01; ###p < 0.001 versus the MI group.
CARDIOVASCULAR JOURNAL OF AFRICA • Volume 33, No 5, September/October 2022 AFRICA 231 detect the expression levels of the above proteins of the wnt/β– catenin signalling pathway. Western blotting and immunohistochemical staining analysis showed that the expression levels of wnt1, GSK3β, MMP9, β-catenin, c-myc and TIMP-1 in the myocardial tissues and fibroblasts were more increased in PRELP over-expression groups than in the MI groups (Fig. 3). The expression levels of the above proteins in the sh-PRELP groups were decreased compared to the MI groups, indicating that PRELP increased the infarct size and promoted myocardial fibrosis and ventricular re-modelling following MI through the wnt/β–catenin signalling pathway in vivo and in vitro. Discussion In our study, we investigated the role of PRELP in ventricular re-modelling and myocardial fibrosis post AMI and explored the underlying mechanism through which PRELP brings about these changes. In our experiments, over-expression of PRELP increased the infarct size and myocardial fibrosis, and decreased the LVFS and LVEF of the heart, compared to the MI groups. By contrast, in the sh-PRELP group, there was a decrease in the infarct size and myocardial fibrosis, and an increase in LVFS and LVEF of the heart, compared to the MI groups. The results indicate that PRELP increased the infarct area and myocardial fibrosis and reduced the cardiac function post MI. The expression of wnt1, GSK3β, MMP9, β-catenin, c-myc and TIMP-1 was greater in the group with over-expression of PRELP than in the MI groups, both in vivo and in vitro. The expression of these proteins in sh-PRELP groups was lower than that in the MI groups. The results indicate that PRELP takes part in myocardial fibrosis and ventricular re-modelling post AMI through the wnt/β–catenin signalling pathway. Several previous studies have shown that other members of the SLRR family such as biglycan, glypican-6 and lumican take part in myocardial fibrosis and ventricular re-modelling.10-12,22,23 Fig. 2. PRELP increased the infarct size and myocardial fibrosis promoted cardiac dysfunction after MI. A. Representative echocardiographic M-mode images of left ventricles from SHAM, MI, MI + PRELP shRNA and MI + PRELP over groups. B. Echocardiographic measurement of LVEF and LVFS in mice in the four groups. C and D. Representative images of heart sections stained with TTC from mice in the four groups; the infarct size (white area) was measured and shown as a percentage of the total section area of the left ventricular myocardium. E–G. Representative images of heart sections stained with haematoxylin and eosin (E) and Sirius red (F and G); F was for myocardial tissues and G was for fibroblasts in the four groups.
CARDIOVASCULAR JOURNAL OF AFRICA • Volume 33, No 5, September/October 2022 232 AFRICA Javier et al. reported, for the first time, that several members of the small leucine-rich proteoglycan family, including asporin and PRELP, contribute to cardiac re-modelling.24 Bengtsson et al. showed that PRELP was an important regulator of cell adhesion, due to the positively charged N-terminal region in its chemical structure.24,25 Fibroblasts can adhere to PRELP and that can be inhibited by heparin.26 However, little research on PRELP’s role in myocardial fibrosis and ventricular re-modelling following AMI has been done. Our study determined the role of PRELP in myocardial fibrosis and re-modelling post AMI. Li et al. reported PRELP promotes osteoblastic differentiation via the β-catenin/connexin 43 pathway, and β-catenin acts as a hub gene in the PRELP gene network.5 Some studies showed that expression of the wnt pathway increased following AMI, and appropriate activation of the wnt pathway can decrease the infarct size of the heart and alleviate heart failure, while excess activation can lead to myocardial fibrosis.16,17 Other studies also noted that the wnt/β– catenin signalling pathway is involved in myocardial fibrosis post MI.27-31 However, there was no research until now that looked at PRELP’s role in myocardial fibrosis through the wnt/β–catenin signalling pathway post AMI. Conclusion Our study has shown for the first time that PRELP takes part in cardiac myofibrosis and ventricular re-modelling following AMI through the wnt/β–catenin signalling pathway. It further identified the cardiac fibrotic molecular mechanisms, provided novel insights into therapeutic targets and uncovered effective strategies to alleviate myocardial fibrosis after AMI. This study was supported by Natural Science Foundation of Shandong Province (ZR2017MH122). Fig. 3. PRELP promoted myocardial fibrosis and cardiac dysfunction after MI on the wnt/β–catenin signalling pathway. A and B. The expression levels of wnt1, GSK3β, MMP9, β-catenin, c-myc and TIMP-1 in myocardial tissues were detected using Western blotting; GAPDH was used as a loading control in these experiments. Data are shown as mean ± SEM. C and D. The expression levels of wnt1, GSK3β, MMP9, β-catenin, c-myc and TIMP-1 in fibroblasts were detected using Western blotting; GAPDH was used as a loading control in these experiments. Data are shown as mean ± SEM. E–G. The expression levels of GSK3β, wnt1 and β-catenin in fibroblasts were detected using immunohistochemical staining analysis. *p < 0.05, **p < 0.01, ***p < 0.001 versus the control group; #p < 0.05; ##p < 0.01; ###p < 0.001 versus the MI group.
CARDIOVASCULAR JOURNAL OF AFRICA • Volume 33, No 5, September/October 2022 AFRICA 233 References 1. Cai Y, Xie KL, Wu HL, et al. Functional suppression of Epiregulin impairs angiogenesis and aggravates left ventricular re-modelling by disrupting the extracellular‐signal‐regulated kinase1/2 signaling pathway in rats after acute myocardial infarction. J Cell Physiol 2019; 234: 18653–18665. 2. Yuan X, Pan J, Wen L, et al. MiR-590-3p regulates proliferation, migration and collagen synthesis of cardiac fibroblast by targeting ZEB1. J Cell Mol Med 2020; 24: 227–237. 3. Shu L, Zhang W, Huang C, et al. LncRNA ANRIL protects H9c2 cells against hypoxia-induced injury through targeting the miR-7-5p/SIRT1 axis. J Cell Physiol 2020; 235: 1175–1183. 4. Gong X, Zhu Y, Chang H, et al. Long noncoding RNA MALAT1 promotes cardiomyocyte apoptosis after myocardial infarction via targeting miR-144-3p. Biosci Rep 2019; 39: BSR20191103. 5. Wang L, Jiang P, He Y, et al. A novel mechanism of Smads/miR-675/ TGFβR1 axis modulating the proliferation and re-modelling of mouse cardiac fibroblasts. J Cell Physiol 2019; 234: 20275–20285. 6. Van Rooij E, Olson EN. Searching for miracles in cardiac fibrosis. Circ Res 2009; 104: 138–140. 7. Furtado MB, Nim HT, Boyd SE, et al. View from the heart: cardiac fibroblasts in development, scarring and regeneration. Development 2016; 143: 387–397. 8. Itoh A, Nonaka Y, Ogawa T, et al. Small leucine-rich repeat proteoglycans associated with mature insoluble elastin serve as binding sites for galectins. Biosci Biotechnol Biochem 2017; 8: 2098–2104. 9. Matsushima N, Takatsuka S, Miyashita H, et al. Leucine rich repeat proteins: sequences, mutations, structures and diseases. Protein Pept Lett 2019; 26: 108–131. 10. Beetz N, Rommel C, Schnick T, et al. Ablation of biglycan attenuates cardiac hypertrophy and fibrosis after left ventricular pressure overload. J Mol Cell Cardiol 2016; 101: 145–155. 11. Chen SW, Tung YC, Jung SM, et al. Lumican-null mice are susceptible to aging and isoproterenol-induced myocardial fibrosis. Biochem Biophys Res Commun 2017; 482: 1304–1311. 12. Melleby AO, Strand ME, Romaine A, et al. The heparan sulfate proteoglycan glypican-6 is upregulated in the failing heart, and regulates cardiomyocyte growth through ERK1/2 signaling. PLos One 2016; 11: e0165079. 13. Bengtsson E, Neame PJ, Heinegård D, et al. The primary structure of a basic leucine-rich repeat protein, PRELP, foundin connective tissues. J Biol Chem 1995; 270: 25639–25644. 14. Barallobre-Barreiro J, Didangelos A, Schoendube FA, et al. Proteomics analysis of cardiac extracellular matrix re modelling in a porcine model of ischemia/reperfusion injury. Circulation 2012; 125: 789–802. 15. Duan J, Xu H, Ma S, et al. Cre-mediated targeted gene activation in the middle silk glands of transgenic silkworms (Bombyx mori). Transgenic Res 2013; 3: 607–619. 16. Hahn JY, Cho HJ, Bae JW, et al. Beta-catenin overexpression reduces myocardial infarct size through differential effects on cardiomyocytes and cardiac fibroblasts. J Biol Chem 2006; 41: 30979–30989. 17. Jones SE, Jomary C. Secreted frizzled-related proteins: searching for relationships and patterns. Bioessays 2002; 9: 811–820. 18. Li H, Cui Y, Luan J, et al. PRELP (proline/arginine-rich end leucine-rich repeat protein) promotes osteoblastic differentiation of preosteoblastic MC3T3-E1 cells by regulating the β-catenin pathway. Biochem Biophys Res Commun 2016; 470: 558–562. 19. Pillai VS, Kundargi RR, Edathadathil F, et al. Identfication of prolargin expression in articular cartilage and its significance in rheumatoid arthritis pathology. Int J Biol Macromol 2018; 110: 558–566. 20. Fernández-Puente P, González-Rodríguez L, Calamia V, et al. Analysis of endogenous peptides released from osteoarthritic cartilage unravels novel pathogenic markers. Mol Cell Proteomics 2019; 18: 2018–2028. 21. Lal H, Ahmad F, Zhou J, et al. Cardiac fibroblast glycogen synthase kinase-3b regulates ventricular re-modelling and dysfunction in ischemic heart. Circulation 2014; 130: 419–430. 22. Hara T, Yoshida E, Shinkai Y, et al. Biglycan intensifies ALK5-Smad2/3 signaling by TGF-β1 and downregulates syndecan-4 in cultured vascular endothelial cells. J Cell Biochem 2017; 118: 1087–1096. 23. Jazi MF, Biglari A, Mazloomzadeh S, et al. Recombinant fibromodulin has therapeutic effects on diabetic nephropathy by down-regulating transforming growth factor-β1 in streptozotocin-induced diabetic rat model. Iran J Basic Med Sci 2016; 19: 265–271. 24. Bengtsson E, Lindblom K, Tillgren V, et al. The leucine-rich repeat protein PRELP binds fibroblast cell-surface proteoglycans and enhances focal adhesion formation. Biochem J 2016; 473: 1153–1164. 25. Liu GH, David E, Martin E, et al. PRELP enhances host innate immunity against the respiratory tract pathogen Moraxella catarrhalis. J Immunol 2017; 198: 2330–2340. 26. Bengtsson E, Aspberg A, Heinegard D, et al. The amino-terminal part of PRELP binds to heparin and heparan sulfate. J Biol Chem 2000; 275: 40695–40702. 27. Sumida T, Naito AT. Complement C1q-induced activation of β-catenin signaling causes hypertensive arterial re-modelling. Nat Commun 2005; 26: 6241. 28. Chen L, Wu Q, Guo F, et al. Expression of dishevelled-1 in wound healing after acute myocardial infarction: possible involvement in myofibroblast proliferation and migration. J Cell Mol Med 2004; 8: 257–264. 29. Popova AP, Bentley JK, Anyanwu AC, et al. Glycogen synthase kinase3β/β-catenin signaling regulates neonatal lung mesenchymal stromal cell myofibroblastic differentiation. Am J Physiol Lung Cell Mol Physiol 2012; 303: L439–L448. 30. Jeong MH, Kim HJ, Pyun JH, et al. Cdon deficiency causes cardiac remodeling through hyperactivation of wnt/β-catenin signaling. Proc Natl Acad Sci USA 2017; 114: E1345–E1354. 31. Lin H, Angeli M, Chung KJ, et al. sFRP2 activates wnt/β-catenin signaling in cardiac fibroblasts: differential roles in cell growth, energy metabolism, and extracellular matrix remodeling. Am J Physiol Cell Physiol 2016; 311: C710–C719.
CARDIOVASCULAR JOURNAL OF AFRICA • Volume 33, No 5, September/October 2022 234 AFRICA Association of microalbuminuria with serum lipids and inflammatory markers in an adult population in the Dikgale Health and Demographic Surveillance System site, South Africa Thabo Magwai, Perpetua Modjadji, Solomon Choma Abstract Background: There is evidence that microalbuminuria (urinary albumin excretion) is an early sign of vascular damage and an established risk factor for cardiovascular morbidity and mortality. This study investigated the magnitude of microalbuminuria and its association with serum lipids and inflammatory markers among a rural black population residing in the Dikgale Health and Demographic Surveillance System site, South Africa. Methods: Data were collected from 602 presumably healthy participants (225 men and 377 women) aged ≥ 18 years. Biochemical data collection included serum lipids, glucose, insulin, high-sensitivity C-reactive protein (hs-CRP), urine albumin and creatinine. Anthropometry and blood pressure were also measured. Microalbuminuria was diagnosed with an albumin–creatinine ratio of ≥ 2.5 mg/mmol in men and ≥ 3.5 mg/mmol in women. Data were analysed using SPSS version 22.0. Results: The mean age of participants was 48.63 ± 20.89 years. High percentages of microalbuminaria (35.7%), high levels of interleukin 6 (17.8%), hs-CRP (32.9%), triglycerides (TG) (26.1%), low-density lipoprotein cholesterol (52.2%) and total cholesterol (32.0%), and low levels of high-density lipoprotein cholesterol (29.1%) were observed in the population. Increased glucose levels (32.8%), insulin resistance (27.6%), hypertension (45.8%), overweight (26.8%) and obesity (25.4%) were also prevalent. Microalbuminuria was associated with high hs-CRP and TG levels in the men (adjusted odds ratios = 9.434, 95% confidence interval: 1.753 – 50.778, p = 0.01). Conclusion: High prevalence of microalbuminuria, hypertension, insulin resistance, overweight and obesity, as well as abnormal levels of serum lipids and inflammatory markers were observed in the population. Microalbuminuria was associated with high hs-CRP and TG levels among men. Keywords: microalbuminuria, serum lipids, inflammatory markers, rural HDSS site, South Africa Submitted 18/5/20, accepted 6/1/21 Published online 12/4/22 Cardiovasc J Afr 2022; 33: 234–242 www.cvja.co.za DOI: 10.5830/CVJA-2021-055 In 2018, the World Health Organisation (WHO) reported that South Africa faces a quadruple burden of disease resulting from communicable diseases (HIV/AIDS and tuberculosis), maternal and child mortality, non-communicable diseases (NCDs) such as hypertension and cardiovascular diseases (CVDs), diabetes mellitus, cancer, mental illnesses and chronic lung diseases such as asthma, as well as injury and trauma.1 Most of the CVD deaths (80%) occur in low- to middle-income countries. In South Africa, NCDs are estimated to account for 43% of the total adult deaths, while CVDs account for almost a fifth (18%) of these deaths.2 One in three South African adults (33.7%) has hypertension, which can increase the risk of heart attack, heart failure, kidney disease or stroke, while 31.3% of adults are obese.2 Contributing factors to CVDs are urbanisation and the population burden of vascular risk factors, such as hypertension, hypercholesterolaemia, low-grade inflammation, as well as diabetes, smoking and obesity.3,4 Microalbuminuria (MA) is an established risk factor for cardiovascular morbidity and mortality and for end-stage renal disease in individuals with associated cardiovascular risk conditions such as hypertension or/and diabetes mellitus.5,6 The leakage of albumin into the urine is thought to be linked to enhanced capillary permeability for albumin in the systemic vasculature and this might lead to haemodynamic strain and instability, which then starts the atherosclerotic process, eventually leading to adverse cardiovascular events.7-9 Another explanation could be endothelial dysfunction, since abnormalities in the endothelial glycocalix can contribute to both MA and the pathogenesis of atherosclerosis, therefore providing a link between MA and CVDs.10 In a South African study, the prevalence of MA was reported to be 58% in the general population, 51% in a diabetic population and 43% in a hypertensive population.11 One of the most significant markers of inflammation appearing during atherosclerosis is C-reactive protein (CRP). This is formed in the liver in response to the development of an inflammatory condition or is due to infection.12 There is a significant relationship between an increased high-sensitivity CRP (hs-CRP) and local disturbances in the structure and function of blood vessels, particularly with abnormal lipid status.13 MA has been associated with high levels of hs-CRP14 and interleukin 6 (IL-6).15 Department of Pathology and Medical Sciences, School of Health Care Sciences, Faculty of Health Sciences, University of Limpopo, South Africa Thabo Magwai, MSc, thabo.magwai9096@outlook.com Perpetua Modjadji, MSc, PhD, DrPH Solomon Choma, MSc Department of Public Health, School of Health Care Sciences, Sefako Makgatho Health Sciences University, South Africa Perpetua Modjadji, MSc, PhD, DrPH
CARDIOVASCULAR JOURNAL OF AFRICA • Volume 33, No 5, September/October 2022 AFRICA 235 Several studies have also reported that chronic low-grade inflammation is associated with MA and the risk of atherosclerosis.16-18 Furthermore, MA was also found to be associated with serum total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C).19,20 Contradicting results wherein MA was not associated with CRP, IL-6 21,22 and serum lipids23 have been reported. Some studies have attributed the contradiction of associations to differences in the study approach, the method of diagnosing MA, control for confounders, or differences in sample size.21,23 Although, the mechanism leading to MA is unclear, the literature documents that endothelial dysfunction may be responsible.24 Associations of endothelial dysfunction with MA,25 dyslipidaemia26 and low-grade inflammation27 have long been reported among patients with conditions such as hyperlipidaemia. MA, together with low-grade inflammation and dyslipidaemia, are the risk factors for CVDs.28-30 Hence, the hypothesis that high levels of serum lipids and inflammatory markers are associated with MA. MA has been reported to be more prevalent in blacks compared to whites in an American population.31,32 This is thought to be due to socio-economic discrepancies, access to healthcare, differences in glycaemic control, or a possible biological or genetic difference in the populations.32 This makes the investigation of MA in a black population essential. Despite the current burden of NCDs, including CVDs, in South Africa,33 there is a paucity of data on the prevalence of MA in the black South African population. Globally, most studies on MA focused separately on either MA and inflammatory markers or MA and serum lipids. As a result, not many studies have reported on the association among these three cardiovascular risk factors. This study was undertaken to determine the prevalence of MA among a presumably healthy black population, and further to determine the association of MA with inflammatory markers and serum lipids. It is noteworthy that MA, together with an evaluation of inflammatory markers and serum lipids, may have a potential role in improving cardiovascular risk prediction. Methods A cross-sectional study using a quantitative method was conducted in a rural black population to determine the association of inflammatory markers and serum lipids with MA. This study is part of a larger study titled ‘Prevention, control and integrated management of chronic diseases in a rural black population, South Africa’. The larger study aimed to identify specific risk factors for chronic diseases in a rural settlement in the Limpopo province, South Africa. The study used a WHO STEPS questionnaire to gather information on socio-economic status and risk factors for NCDs with questions covering different cardiovascular risk factors.8 The study setting has previously been reported by Alberts et al.34 The study was conducted in the Dikgale Health and Demographic Surveillance System (DHDSS) site, a rural site in the Limpopo Province of South Africa, situated approximately 40 km north-east of Polokwane, the capital of Limpopo Province. The area constitutes communities typically made up of households clustered in villages with a population of approximately 36 000, speaking the local language of Sepedi. In 2009, the site was enlarged from eight to 15 villages. The area has poor infrastructure with minimal use of available electricity and shared or communal taps for water supply.34 The site has a socioeconomic status characterised by high rates of unemployment and singlehood, and low rates of tertiary education.35-38 These living conditions are consistent with the findings of the South African National Health and Nutrition Examination Survey (SANHANES-1).39 In a larger study, 2 981 participants were selected randomly from the DHSSS database. Only participants aged 18 years old and above were selected to participate in the study. Of the 2 981, only 1 407 participants completed the WHO STEPS questionnaire, of whom 878 were women and 525 were men. Only 817 of the participants were available to donate fasting blood samples. Reasons for the low participation were leaving for work early in the morning, unavailability after repeated visits, refusal to participate, death or emigration.35 The WHO STEPS questionnaire was first translated into Sepedi (a local language), and the field workers were then trained in the administration and understanding of the questionnaire during a pilot study to pre-test its feasibility among participants who did not form part of the main study. The current study included participants who gave written consent to take part in the study, completed the WHO STEPS questionnaire, and gave both blood and urine samples. The study excluded participants with albumin/creatinine ratio (ACR) > 2.5 mg/mmol in males and > 3.5 mg/mmol in females,40 and participants with confounders such as renal disease (serum creatinine of ≥ 170 µmol/l), diabetes (glucose of ≥ 7.0 mmol/l and/or history of diabetes), pregnant women and HIV-positive participants. Furthermore, participants who were on medication for diabetes and HIV, or using lipid-lowering drugs were excluded to avoid interference with serum lipids. The final sample of 602 participants was obtained. As part of the larger study, a spot urine sample was collected into a sterile urine jar from each participant. Blood was collected in silica-coated vacutainer tubes, EDTA-containing tubes and sodium fluoride tubes. Blood samples were centrifuged and immediately after centrifugation, serum lipids, hs-CRP, glucose, insulin, HIV status and creatinine were determined. The remaining serum was stored in cryotubes at –80°C for further determination of IL-6. The frozen samples were aliquoted to minimise freeze–thaw cycles on individual tubes, thus preserving the sample quality and integrity. Serum hs-CRP levels were measured using the IMMAGE 800 immunochemistry system. Insulin and IL-6 were determined using the ACCESS 2 chemistry system. Serum lipid (TG, cholesterol, HDL-C and LDL-C) and glucose levels were determined using the ILAB 300 plus chemistry system. Spot morning urine samples were collected using a sterile urine jar. Urine creatinine and albumin concentrations were measured using the ILAB 300 plus chemistry system and the ACR was calculated. Subjects with an ACR of 2.5–25 mg/mmol in males and 3.5–35 mg/mmol in females40 were considered microalbuminuric and subjects with an ACR of < 2.5 mg/mmol in males and < 3.5 mg/mmol in females were considered normoalbuminuric (NA). Subjects with MA were regarded as the cases and subjects with NA were regarded as controls for this study. Anthropometry (weight, height and waist circumferences) were all measured according to the WHO procedures. Weight was measured using a calibrated smart D-quip electronic scale
CARDIOVASCULAR JOURNAL OF AFRICA • Volume 33, No 5, September/October 2022 236 AFRICA and recorded to the nearest 0.1 kg while height was measured using a stadiometer and recorded to the nearest 0.1 m. For both weight and height, two measurements were taken by two different and independent research assistants. The average was recorded as the weight of the participants. The absolute technical error of measurement was 0.017 kg for weight measurements and 0.005 m for height measurements. In the study, the authors could not measure the intra-equipment variance. Overweight was defined as body mass index of between 25 and 29.9 kg/m2 and obesity was defined as body mass index of ≥ 30 kg/m2. A non-stretchable plastic tape measure was used to measure the waist circumferences (WC) and values were recorded to the nearest 0.1 cm. Two WC measurements were taken by two independent research assistants. The absolute technical error of measurement for WC was 0.012 cm. Abdominal obesity was defined by a waist circumference ≥ 80 cm for women and ≥ 94 cm for men.41 Blood pressure was measured using OMRON M-5 (OMRON UK) according to the WHO procedure. Blood pressure measurements were taken with participants in a seated position with a flexed elbow at the level of the heart. An appropriately tight blood pressure cuff was placed around the upper arm with its lower edge just above the antecubital fossa. The cuff was inflated to measure systolic blood pressure and released for diastolic blood pressure. Three measurements were taken and the average of the last two readings was reported. Participants with a systolic blood pressure (SBP) of ≥ 140 mmHg, diastolic blood pressure (DBP) of ≥ 90 mmHg and/or history of hypertension were considered hypertensive.42 This study was conducted according to the guidelines laid down in the Declaration of Helsinki43 and all procedures involving human subjects were approved by the Medunsa Research and Ethics Committee (MREC) [MREC/HS/102/2014:PG]. The nature of the study was explained to the subjects and written informed consent was obtained from parents and verbal assent from learners. Statistical analysis Data were analysed using the statistical package for social sciences (SPSS) version 22.0. Normally distributed data (Gaussian distribution) are presented as mean ± standard deviation and the skewed data were normalised through a logarithm transformed for further analysis and are presented as median (interquartile range). The Student’s t-test was used to compare serum lipids and inflammatory markers between participants with and without MA. Analysis of variance (ANOVA) was used to control for age in the comparison of parameters between participants with and without MA. Multiple logistic regression analysis was used to determine the association of MA with serum lipids and inflammatory markers. A simple logistic regression was used to determine the bi-variate relationship between MA and predictors. Predictors with a p-value ≤ 0.250 were entered into the first adjusted model and those with the weakest prediction (with p > 0.250) were removed and the model was run again to get the last adjusted model. The model was used to control for known confounders measured in this study, such as age, gender, blood pressure, high glucose and creatinine levels, to mention a few. Adjusted odds ratios (AOR) with a 95% confidence interval (CI) were generated and used to determine the independent strength of the associations. Results are presented as AOR (95% CI). Significance was set at the probability level of p < 0.05. Results Table 1 presents demographic and biochemical data for males and females. In this population, women were found to be significantly older and had a significantly higher ACR compared to their male counterparts (p = 0.03 and 0.02, respectively). Women were also found to have a significantly higher hs-CRP and TC/HDL-C ratio when compared to men (p = 0.01, 0.00 and 0.04, respectively). Men had a significantly higher estimated glomerular filtration rate (eGFR) and serum creatinine compared to women (p = 0.00 and 0.00, respectively). The prevalence of a high hs-CRP and TC was significantly higher in women that in men (p = 0.00 and 0.0, respectively). More men were found to have a lower HDL-C compared to women (p = 0.00). The prevalence of a high TC/HDL-C ratio was significantly higher in women than in men (p = 0.00 and 0.03, respectively). Table 2 presents anthropometric and blood pressure data in men and women. Women were found to have a higher body mass Table 1. Demographic and biochemical data of males and females Variables All (n = 602) Female (n = 377) Male (n = 225) p-value Age (years) 48.63 ± 20.89 50.14 ± 19.82 46.22 ± 22.44 0.03 ACR (mg/mmol) 2.04 (1.05–4.71) 4.11 ± 5.39 3.18 ± 3.53 0.02 Glucose (mmol/l) 5.15 ± 0.84 5.16 ± 0.85 5.13 ± 0.83 0.71 Insulin (µIU/l) 6.23 (3.33–1.85) 6.42 (3.50–12.63) 5.60 (3.20–10.67) 0.33 HOMA 1.81 ± 1.33 1.85 ± 1.31 1.74 ± 1.36 0.31 IL-6 (pg/ml) 3.09 (1.96–4.94) 2.74 (1.96–3.81) 3.01 (1.81–4.84) 0.12 hs-CRP (mg/l) 1.50 (0.56–4.28) 1.83 (0.65–5.35) 1.26 (0.47–2.76) 0.01 TC (mmol/l) 4.45 ± 1.23 4.54 ± 1.29 4.33 ± 1.06 0.05 HDL-C (mmol/l) 1.34 ± 0.51 1.34 ± 0.59 1.33 ± 0.32 0.78 LDL-C (mmol/l) 2.54 ± 1.09 2.66 ± 1.04 2.41 ± 0.93 0.00 TG (mmol/l) 1.11 (0.73–1.68) 1.11 (0.72–1.70) 1.10 (0.74–1.58) 0.91 TC/HDL-C 3.52 ± 1.13 3.59 ± 1.16 3.39 ± 1.06 0.04 eGFR (ml/min/1.73 m2) 97.34 ± 24.07 93.65 ± 23.51 103.49 ± 23.8 0.00 Creatinine (µmol/l) 82.31 ± 19.81 79.28 ± 18.31 87.55 ± 21.17 0.00 MA, n (%) 215 (35.7) 128 (34.0) 87 (38.7) 0.24 Age (< 40 years), n (%) 221 (36.7) 119 (31.6) 102 (45.3) 0.00 Age (40–59 years), n (%) 173 (28.7) 127 (33.7) 42 (20.4) Age (> 60 years), n (%) 208 (34.6) 131 (34.7) 77 (34.2) High glucose (≥ 5.6 mmol/l), n (%) 197 (32.8) 128 (34.0) 69 (30.7) 0.39 High HOMA (> 2.5), n (%) 166 (27.6) 106 (28.2) 60 (26.7) 0.69 High IL-6 (≥ 5 pg/ml), n (%) 32 (17.8) 14 (13.9) 18 (22.8) 0.12 High hs-CRP (≥ 3 mg/l), n (%) 198 (32.9) 146 (38.7) 52 (23.2) 0.00 High TC (≥ 5.0 mmol/l), n (%) 187 (32.0) 130 (35.5) 57 (26.1) 0.02 Low HDL-C (1.1 and 1.3 mmol/l), n (%) 167 (29.1) 85 (23.6) 82 (38.5) 0.00 High LDL-C (≥ 3.0 mmol/l), n (%) 295 (52.2) 195 (55.2) 100 (47.2) 0.06 High TG (≥ 1.7 mmol/l), n (%) 151 (26.1) 103 (28.1) 48 (22.5) 0.14 ACR, albumin–creatinine ratio; HOMA, homeostatic model assessment; IL-6, hs-CRP, high-sensitivity C-reactive protein; TC, total cholesterol; HDL-C, highdensity lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; TG, triglycerides; eGFR, estimated glomerular filtration rate; MA, microalbuminaria.
RkJQdWJsaXNoZXIy NDIzNzc=